|
Methods
|
|
|
| |
|
|
|
Primer Design
There are several commercially available
software packages that include primer design applications. We use
Vector NTI Suite 8, following the steps outlined below. The same
guidelines for mRNA sequence selection can be followed no matter
which software package you use. |
| 1. |
Import the gene of interest
into Vector NTI Suite 8 using the Accession number of the mRNA sequence.
If available, use the Reference sequence (RefSeq), which is the
most complete sequence for a given gene. The RefSeq for mRNA
begins with the prefix NM. For example, NM_123456. In the
main window, go to Tools ? Open ? Retrieve
DNA-RNA by GenBank NID… insert the Accession number. |
| 2. |
Starting at
the 3' end of the sequence, select 500-1000 bases of sequence |
| |
a. |
The sequence should not include runs of
more than four repeated bases in a row (for example, TTTTT or GGGGG);
these sequences will cause secondary structures in the DNA and the
PCR will likely fail |
| |
b. |
Avoid sequences that have large sections of GC repeats
or AT repeats; the higher the sequence complexity, the greater the
chances are of a successful PCR reaction. |
| |
c. |
If there is no sequence in
the 3' area that matches these criteria, continue to move in the
5' direction until an adequate sequence is found. |
| |
|
|
| 3. |
To ensure the sequence is unique
to the desired gene perform a BLAST search. With the desired sequence
highlighted, click Tools? Blast Search ? Selection
Only, Direct ? NCBI Blast Server ? OK .
Then click on the Parameters tab, click on “select from”
and choose Mus musculus . Click Submit. |
| |
|
| 4. |
When the BLAST search is complete, open it by double-clicking
on the name of the gene. |
| |
a. |
If the molecular “hits” have an Accession number that
falls under the same GeneID and/or UniGene Cluster as the desired
gene, the homologous region can be ignored. |
| |
b. |
If the “hit” is a large genomic
sequence (as opposed to mRNA sequence), it can be ignored. |
| |
c. |
If there is
a molecule of greater than 50 bases that has a different GeneID
and/or UniGene number than the desired gene, a new region of the
desired gene needs to be selected and steps 4 and 5 should be repeated
until a unique sequence region is identified.
(Note: The GeneID can be found at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene
, and the UniGene Cluster at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=unigene
). |
| 5. |
After a good sequence is selected and is verified as
unique, the primers are designed. With the sequence highlighted in
the Vector NTI window, click Analyses ? Primer Design
? Find PCR Primers… |
| |
a. |
Under the Primers tab, the product length should
be from 500 to 800 base pairs. |
| |
b. |
Under “Attach
to 5' terminus of Antisense Primer,” type GCGGTAATACGACTCACTATAGGGC
. This is the T7 promoter sequence needed for the in vitro
transcription reaction, with an additional three bases (GCG) added
to ensure the entire T7 sequence is present after the oligonucleotide
is synthesized.
(Note: If “Attach to 5' terminus”
heading is not visible, click “More>>”) |
| |
c. |
All other settings remain as
the default settings. Click “OK.” |
| |
|
|
| 6. |
Select the primer set with
the highest primer rating. The maximum primer rating is 171. A primer
set with a primer rating lower than 153 is never used. |
| |
|
| 7. |
The primers can now be submitted for synthesis. |
| |
|
| For
detailed protocols, please click on Links below:
• Primer
Disign
• Generation
of cDNA
- RNA isolation
- RT-PCR
• PCR
amplification of template DNA |
Email this Page (Must login first)
|
BookMark this Page