Welcome to the Mousebrain Gene Expression Map at St. Jude Children’s Research Hospital in Memphis, TN. This database contains gene expression patterns assembled from mouse nervous tissues at 4 time points throughout brain development including embryonic (e) day 11.5, e15.5, postnatal (p) day 7 and adult p42. Using a high throughput in situ hybridization approach we are assembling expression patterns from selected genes and presenting them in a searchable database. The database includes darkfield images obtained using radioactive probes, reference cresyl violet stained sections, the complete nucleotide sequence of the probes used to generate the data and all the information required to allow users to repeat and extend the analyses. The database is directly linked to Pubmed, LocusLink, Unigene and Gene Ontology Consortium housed at the National Center for Biotechnology Information (NCBI) in the National Library of Medicine. These data are provided freely to promote communication and cooperation among research groups throughout the world.
Acknowledgments
The St. Jude Brain Gene Expression Map (BGEM) project is managed by Tom Curran, Ph.D., Patricia Jensen, Ph. D., and Susan Magdaleno, Ph. D. in the Department of Developmental Neurobiology at St. Jude Children’s Research Hospital.
Technical expertise is provided by Karen Lehman, Andrew Asbury, Tony Cheung, Tommie Cornelius, Diana Batten, and Christopher Eden. Custom primer design for generating riboprobe template for in situ hybridization analysis is performed in part by The National Center for Biotechnology Information (NCBI).
The St. Jude BGEM website is built and maintained by software engineers Nileshwar Dosooye, and Sundeep Shakya and the Bioinformatics programs were written by Perdeep Mehta, Ph.D in the Hartwell Center for Bioinformatics and Biotechnology at St. Jude Children’s Research Hospital.
The BGEM project is part of the Gene Expression Nervous System Atlas (GENSAT) funded by the National Institute for Neurological Disorders and Stroke (NINDS), National Institute of Mental Health (NIMH), and National Institute for Drug Abuse (NIDA) at the NIH and the American Lebanese Syrian Associated Charities (ALSAC) at St. Jude Children’s Research Hospital.
Navigating the database
Visitors can browse through the images using the gene list icon located in page headings above. The gene list can be alphabetized according to Genbank accession #, Gene Identification and Description, or by the official Gene symbol in order from A-Z or Z-A. Specific genes can be identified using the search icon located in the headings. Visitors can search for specific genes, spatial and temporal expression patterns, keywords, chromosomal location, and gene ontology terms. Individual accounts can be established free of charge that allow account holders to save collected images for future visits to the website.
Viewing images in the Database
There are several ways to view the images.
1. The entire set of thumbnail size images for each gene can be browsed on the main gene page
2. A single darkfield image can be viewed side-by-side with nearest reference cresyl violet stained section
3. A large image can be viewed on the monitor or downloaded as a high resolution photographic quality image (300 dpi) image at 5.5×3.607 inches.
4. Selected images can be saved to a gene expression viewer that allows side-by-side comparison of expression patterns.
Genes in the Database
The genes represented in this database are members of a variety of gene families with wide distribution in gene ontology and chromosomal location. Many genes were selected by a broad panel of neuroscience experts in the fields of Development, Neurodegeneration, Receptors/Channels and Cognitive Neuroscience based on their interest to the research community. In addition, many genes in the database have no known function in the nervous system, or are completely uncharacterized. We have included these uncharacterized genes to facilitate new discoveries and to stimulate novel research directions in neurobiology. We found that 65% of the genes in the database, regardless of their origin, display a “patterned” distribution of mRNA in either the temporal or spatial dimension. We are continually adding new genes to the database with the ultimate goal of representing the majority of genes that are expressed in the developing and adult brain.
Tissue Processing
C57BL/6 mice (Harlan) are maintained at St. Jude Children’s Research Hospital animal care facility in accordance with the NIH Guidelines for the care and use of laboratory animals. Mice are kept on a twelve-hour light cycle with food and water ad libitum.
Embryonic day 11.5 (E11.5), E15.5, postnatal day 7 (P7) and P42 tissues are collected and fixed with 4% paraformaldehyde (PFA). Following overnight fixation tissue is rinsed with 0.1M phosphate buffered saline (PBS), dissected and cryo-protected overnight in 30% sucrose in PBS. For each time-point tissue is embedded in a Cryomold® (Sakura Finetek USA, Inc.) containing TBS Tissue Freezing Media (Triangle Biomedical Sciences) and frozen on dry ice.
For each block of tissue 16 µm cryo-sections are collected onto 51 SuperFrost Plus slides (Fisher Scientific). A total of 101 sections are collected for the E11 block and P42 coronal block and 151 sections for the E15 block, P7 block and P42 sagittal block. The first section of each block is collected on slide 0. The remaining sections are collected on slides 1-50. Each slide contains sections at approximately 800 µm intervals, i.e. slide 1 contains sections 1, 51, etc. For each set of 51 slides generated, slide 0 and every 10 th slide are stained with cresyl violet to be used as reference slides. The remaining 45 slides are each hybridized with a unique probe. Since each section contains multiple pieces of tissue each probe is hybridized to 55 pieces of tissue representing three planes of section and four developmental ages.
Generation of Template DNA
Primer Design
There are several commercially available software packages that include primer design applications. We use Vector NTI Suite 8, following the steps outlined below. The same guidelines for mRNA sequence selection can be followed no matter which software package you use.
1. Import the gene of interest into Vector NTI Suite 8 using the Accession number of the mRNA sequence. If available, use the Reference sequence (RefSeq), which is the most complete sequence for a given gene. The RefSeq for mRNA begins with the prefix NM. For example, NM_123456. In the main window, go to Tools ? Open ? Retrieve DNA-RNA by GenBank NID… insert the Accession number.
2. Starting at the 3′ end of the sequence, select 500-1000 bases of sequence
a. The sequence should not include runs of more than four repeated bases in a row (for example, TTTTT or GGGGG); these sequences will cause secondary structures in the DNA and the PCR will likely fail
b. Avoid sequences that have large sections of GC repeats or AT repeats; the higher the sequence complexity, the greater the chances are of a successful PCR reaction.
c. If there is no sequence in the 3′ area that matches these criteria, continue to move in the 5′ direction until an adequate sequence is found.
3. To ensure the sequence is unique to the desired gene perform a BLAST search. With the desired sequence highlighted, click Tools? Blast Search ? Selection Only, Direct ? NCBI Blast Server ? OK . Then click on the Parameters tab, click on “select from” and choose Mus musculus . Click Submit.
4. When the BLAST search is complete, open it by double-clicking on the name of the gene.
a. If the molecular “hits” have an Accession number that falls under the same GeneID and/or UniGene Cluster as the desired gene, the homologous region can be ignored.
b. If the “hit” is a large genomic sequence (as opposed to mRNA sequence), it can be ignored.
c. If there is a molecule of greater than 50 bases that has a different GeneID and/or UniGene number than the desired gene, a new region of the desired gene needs to be selected and steps 4 and 5 should be repeated until a unique sequence region is identified.
(Note: The GeneID can be found at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene , and the UniGene Cluster at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=unigene ).
5. After a good sequence is selected and is verified as unique, the primers are designed. With the sequence highlighted in the Vector NTI window, click Analyses ? Primer Design ? Find PCR Primers…
a. Under the Primers tab, the product length should be from 500 to 800 base pairs.
b. Under “Attach to 5′ terminus of Antisense Primer,” type GCGGTAATACGACTCACTATAGGGC . This is the T7 promoter sequence needed for the in vitro transcription reaction, with an additional three bases (GCG) added to ensure the entire T7 sequence is present after the oligonucleotide is synthesized.
(Note: If “Attach to 5′ terminus” heading is not visible, click “More>>”)
c. All other settings remain as the default settings. Click “OK.”
6. Select the primer set with the highest primer rating. The maximum primer rating is 171. A primer set with a primer rating lower than 153 is never used.
7. The primers can now be submitted for synthesis.
Generation of cDNA
RNA isolation
RNA is isolated from neonatal mouse brain or liver. Dissect out tissue, cut into small pieces using a sterile razor blade or scalpel and place in a 1.7-ml microcentrifuge tube. Freeze in liquid nitrogen and store at -80°C. When ready to isolated RNA remove from -80°C and place on dry ice. Isolate RNA in TriPure Isolation Reagent (Roche Molecular Biochemicals, Indianapolis , IN ) using a dounce or power homogenizer. We use a PolyTron power homogenizer following the steps outlined below.
• Place 4-5 ml of depc-treated ddH 2 O in a 13-ml screw-cap tube (Sarstedt, Newton , NC ). Submerge the PolyTron probe in the water and turned on for 10-12 seconds. Repeat this with two fresh tubes of depc-ddH 2 O to rinse thoroughly.
• Rinse three additional times as described above with tubes containing 4-5 ml TriPure.
• Quickly place frozen tissue into a tube with 4 ml TriPure. (For brain tissue, 2 brains per tube; for liver, 1 lobe per tube).
• Pulse for 6 seconds 6 times, with 3-second rests separating pulses. Make sure that the probe reaches near the bottom of the tube without allowing the TriPure to flow over the top of the tube.
• Clean the probe several times with TriPure, followed by several rinses with depc-ddH 2 O.
• Incubate the tissue homogenate for 5 minutes at room temperature.
• Add 0.8 ml of chloroform and shake vigorously for 15 seconds.
• Incubate at room temperature for 15 minutes.
• Centrifuge at 12,000 x g for 15 minutes at 4°C.
• Carefully transfer the clear upper aqueous phase to a new tube.
• Add 2 ml of isopropanol and invert several times to mix.
• Incubate for 10 minutes at room temperature.
• Centrifuge at 12,000 x g for 10 minutes at 4°C. Discard supernatant.
• Add 4 mls of 75% ethanol (freshly diluted from 100% EtOH using depc-ddH 2 O) and mix gently until pellet is dislodged from tube.
• Centrifuge at 7,500 x g for 5 minutes at 4°C. Discard supernatant.
• Uncap tube and dry at room temperature for 10 minutes.
• Vacuum dry at 30°C for an additional 5-10 minutes.
• Resuspend pellet in 500 µl 10 mM Tris (pH 8.0), depc ddH 2 O. Place tube in 55°C water bath for 30 minutes to completely dissolve RNA pellet.
• Make a 1/100 dilution of the final RNA solution; measure the absorbance of the sample at wavelengths of 260 nm and 280 nm to quantify the RNA concentration.
• Aliquot the RNA into sterile microcentrifuge tubes and store at -20°C.
RT-PCR
• Combine the following reagents:
5x iScript Reaction Mix (BioRad, Hercules, CA) 4 ul
iScript Reverse Transcriptase (BioRad) 1 ul
depc-treated ddH2O 13 ul
P0 brain RNA (500 ng/ul) 2 ul
• Incubate as follows:
5 minutes at 25°C
30 minutes at 42°C
5 minutes at 85°C
Hold at 4°C
• Store cDNA at -20°C.
PCR
• Prepare master mix (keep on ice).
Per reaction:
4 µl cDNA
1 µl 10 mM dNTPs
10 µl 5x Q solution ( Qiagen , Valencia , CA)
5 µl 10x PCR Buffer (Qiagen)
2.5 µl 25 mM MgCl 2
24.5 µl sterile ddH 2 O
1 µl Taq Polymerase (Qiagen)
• Aliquot 48 µl of master mix to each tube containing 1 µl of forward primer and 1 µl of reverse primer (10 mM).
• PCR conditions:
1 cycle
95°C
for 5 minutes
40 cycles
95°C
for 1 minute
55°C
for 1 minute
72°C
for 3 minutes
1 cycle
72°C
for 10 minutes
Hold
4°C
• Run 2 µl of PCR product on a 1.5% agarose gel for 40 minutes at 100V to determine that your products are the correct size.
• Purify PCR products using QIAquick PCR Purification kit from Qiagen according to the manufacturers instructions.
• Elute the DNA with 40ul of 10 mM Tris-depc ddH 2 O and store at 4°C.
• Confirm all PCR products by sequencing.
• Once the template sequence is confirmed, store at -80°C.
In Situ Hybridization
Generation of Riboprobe
- Prepare master mix (keep on ice).
per reaction:
2.6 µl H 2 O
1.4 µl 10X Transcription buffer (Ambion #8151G)
0.5 µl 2 mM rNTPs (Promega)
0.5 µl appropriate RNA Polymerase Plus (20U/ µl) We use Polymerase Plus (Ambion # 2716, 2732, or 2703) which contains an Rnase inhibitor. If Polymerase Plus is not used, add 1 µl RNase Inhibitor and subtract 1 µl of H 2 O in each reaction. Replace H 2 O with depc- H 2 O.
- Aliquot 5 µl of master mix to each tube or well containing 4 µl of DNA (0.125 µg/µl).
- Under the radiation hood, aliquot 5 µl of 33P-UTP 0.01 mCi/µl (Perkin-Elmer) to each tube or well.
- If using a 96-well plate format, incubate in the Robocycler at 37 ° C for 1 hour. If using individual tubes, incubate under the radiation hood water bath at 37 ° C for 1 hour.
- Prepare Dnase I reaction mix (keep on ice)
Per reaction:
30.5 µl H 2 O
3.5 µl RQ1 DNase 10X Buffer (Promega #M198A)
1.0 µl RQ1 RNase-free DNase (Promega #M6101)
- Add 35 µl of RQ1 DNase I reaction mix into each tube or well. If using a 96-well plate format, incubate in Robocycler at 37 ° C for 30 minutes. If using individual tubes, incubate in water bath at 37 ° C for 30 minutes.
- Riboprobe purification.
If using 96-well plate format:
Remove seals from a Preforma DTR96-well plate purification kit (Edge Biosystems). Place lid on top and flat-bottom 96-well collection plate under columns. To pack columns centrifuge for 3 minutes at 850 x g . (Do this step no more than 10 minutes before use.) Discard flat-bottom 96-well collection plate containing eluate. Place V-bottom plate under packed columns. Using a multi-channel pipetter, slowly transfer riboprobe onto the center of each packed column. Centrifuge for 3 minutes at 850 x g . Discard columns; save V-bottom 96-well plate tube containing ~45 µl of purified riboprobe in each well.
If using individual tube format:
For each reaction, briefly vortex one ProbeQuant G-50 Micro Column (Amersham Biosciences). Unscrew cap 1/4 of a turn and break off tip. Place in collection tube and centrifuge at 3000rpm for 2 minutes to pack column (do this step no more than 10 minutes before use). Discard collection tubes. Pipette all of probe reaction mixture onto the center of each packed column, recap and and place into the 2 nd set of labeled tubes. Centrifuge at 3000rpm for 2 minutes. Discard columns and save tubes containing ~45 µl purified riboprobe.
- Count 1 µl of probe. Add 1 µl of riboprobe to scintillation vial containing 5 ml of scintillation fluid (LSC-cocktail Scintisafe 30%, Fisher).
-From the probe count, calculate the appropriate amount of probe (1,000,000 counts per slide) to add during hybridization treatment: (1,000,000)(# of slides) / (probe count) = # µl of probe.
Hybridization
All steps are carried out using glass staining dishes (Whatman) and metal slide racks (50 slides/rack). For smaller runs use Tissue Tek Staining set (VWR).
• Remove slides from -80°C and allow them to come to room temperature.
• Treat slides for 10 minutes with 0.0005% proteinase K solution.
For 500 ml proteinase K solution, add:
50 ml of 1M Tris-HCl buffer, pH = 8.0 (Fisher)
125 µl of proteinase K (10mg/ml) (Fisher)
50 ml of 0.5 M EDTA (pH = 8.0) (Fisher)
400 ml of depc-H 2 O
• Rinse slides in 600 ml depc-H 2 O for 3 minutes
• Rinse slides in 500 ml of 0.1 M TEA (pH = 8.0) for 3 minutes
For 1L of 0.1 M TEA:
13.4 ml of 7.5 M Triethanolamine (TEA) (Sigma)
985.6 ml depc-H 2 O
Adjust pH to 8.0 with glacial acetic acid.
• Acetylate slides for 10 minutes.
For 500 ml:
Pipette 1.25 ml of acetic anhydride (Sigma) into dry dish.
Add remaining 500 ml of 0.1 M TEA
• Rinse slides in 600 ml 2X SSC / depc-H 2 O for 3 minutes
• Dehydrate in graded series of ethanol (50, 70, 90 and 100%) for 3 minutes each and allow slides to air dry.
• Prepare probe cocktail:
The probe cocktail consists 50% of 2X hybridization buffer, 50% Formamide, and 0.1% SDS. Calculate the amount of each solution you will need for the TOTAL number of slides to be hybridized for each probe. For each slide add:
- 50 µl Formamide (Fisher)
- 0.5 µl 20% SDS
- 50 µl
Boil probe for 10 minutes at 100 ° C using either the Robocycler or Thermomixer, and store on ice until ready to use. Bring the Thermomixers to 60 ° C. Shake the tubes of hybridization cocktail in the Thermomixer. Leave tubes in the Thermomixer until ready to add riboprobe.
Add calculated amount of probe (depending on scintillation counts) into the hybridization cocktail to obtain 1 x 10 6 cpm/slide of hybridization solution. Shake in Thermomixer at 60 ° C until ready to hybridize to slides.
Add 100 µl riboprobe cocktail to each slide, coverslip or sandwich slides together, and incubate slides in a humid chamber at 60 ° C overnight.
Post-Hybridization
All steps are carried out using glass staining dishes (Whatman) and metal slide racks (50 slides/rack). For smaller runs use Tissue Tek Staining set (VWR).
• While slides are still warm, gently remove coverslips and place slides directly into prehybridization racks soaking in 2 X SSC/50% Formamide at RT (slides should not be exposed to air). Discard old coverslips into radioactive sharps box.
• Rinse slides in 600 ml 2 X SSC for 15 minutes
• Treat slides with 600 ml Rnase A solution at 37 ° C for 30 minutes
For 600 ml Rnase A solution:
60 ml 5 M NaCl
6 ml 1 M Tris-HCl (pH = 8.0)
1.8 ml 0.5 M EDTA (pH = 8.0)
0.48 ml of 25mg/ml Rnase A (Sigma)
531.72 ml H2O
• Rinse slides in 600 ml post hybridization buffer at 60 ° C for 30 minutes
For 600 ml post hybridization buffer solution:
60 ml 5 M NaCl
6 ml 1 M Tris-HCl (pH = 8.0)
1.8 ml 0.5 M EDTA (pH = 8.0)
532.2 ml H2O
• Rinse slides in 2 X SSC at 60 ° C for 1 hour
• Rinse slides in 0.2 X SSC at 60 ° C for 1 hour
• Dehydrate slides in graded series of ethanols (50, 70, 95, 100%) for 5 minutes each.
• Allow slides to air dry
• Tape slides into a film cassette and expose to Biomax MR film overnight.
Emulsion
The autoradiographs are used to measure the strength of probe signal. If the signal for a probe is very dark, expose slides to emulsion for 1 day. If the signal is medium or light, those slides should be exposed for 3 days. If the signal is light or invisible, those slides should be exposed for 7 days.
The following steps are done in the dark room. Emulsion CANNOT be exposed to light.
For small runs (< 50 slides) liquefy Kodak NTB2 emulsion in a 42 ° C water bath for approximately 45 minutes. Divide into 18 ml aliquots and store in a aluminum foil wrapped box at 4 ° C refrigerator until ready to use. When ready to use, liquefy aliquot for about 10 minutes in a 42 ° C water bath. Add 6 ml of 42 ° C dd-H 2 O for a 3:1 dilution.
For large runs, heat one bottle of refrigerated Kodak NTB2 emulsion and a tube of 39.3 ml of ddH 2 O in a 42 ° C water bath for approximately 45 minutes or until the emulsion is completely liquefied. Combine water and emulsion for a 3:1 dilution and rotate container gently to mix thoroughly, avoiding bubbles.
Pour the 3:1 emulsion mixture into a dip miser (Electron Microscopy Sciences). Dip each slide in emulsion up to the frosty label without generating bubbles.
Wipe the back of each slide with dampened sterile gauze to remove emulsion. Stand each slide upright in drying rack lined with paper towels to wick away excess emulsion.
Allow slides to dry at least 2 hours in the dark . Place slides in a slide box with plenty of desiccant (AGM Container Control). Wrap each slide box with 2 pieces of aluminum foil.
Store wrapped slide boxes for the appropriate amount of time (1 day, 3 days, 7 days, etc.) at 4 ° C.
Developing Slides
Prepare Developer and Fixer prior to use:
(Sigma P-5670)
Slowly add an entire bag of Kodak D-19 Developer to 3.8L H 2 O (1 gallon) and mix solution thoroughly with a large stir bar on a stir plate while warming on “low” setting.
Filter 500 ml fixer into 500 ml amber glass bottles with tightly fitting caps (the liquid should take up most of the bottle). Store at RT until ready to use. This solution is highly sensitive to light and oxygen. Oxidized solution will not work properly.
Kodak Fixer (Sigma #P-6557)
Slowly add an entire bag of Kodak Fixer to 3.8L H 2 O (1 gallon) and mix solution thoroughly with a large stir bar on a stir plate.
Filter 500 ml fixer into 500 ml amber glass bottles with caps (the liquid should take up most of the bottle). Store at RT until ready to use. This solution is highly sensitive to light and oxygen. Oxidized solution will not work properly.
Remove the wrapped slide boxes from 4 ° C and allow them to reach room temperature for about 2 hours. Keep the box closed and wrapped in foil until ready to develop the slides.
All steps occur in glass staining dishes and solutions are maintained at 15°C.
• Dilute D-19 developer (Kodak) 1:1 with water and incubate slides for 4 minutes (Gently agitate once).
• Wash slides in water for 2 minutes (Gently agitate once).
• Fix slides in Kodak fixer for 5 minutes (Gently agitate once).
• Rinse slides in gently running water for AT LEAST 2 hours
Dehydrate slides in a graded series of ethanol and clear in Citrisolv for 5 minutes each.
50% EtOH
70% EtOH
95% EtOH
100% EtOH (x3)
CitriSolv (x3)
Solutions
20% SDS stock solution
Mix 20 g sodium lauryl sulfate or sodium dodsyl sulfate (SDS) and 100 ml depc-H 2 O. Store at room temperature.
2X hybridization buffer
For 50 ml:
14.21 ml depc-H 2 O
12 ml 5M NaCl (Ambion #9759)
1 ml 1 M Tris-HCl buffer, pH = 8.0 (Fisher, #BP1758-500)
330 µl 6% Ficoll (Pharmacia Biotech #170400-01)
330 µl 6% polyvinylpyrrolidone (Sigma #PVP-40)
330 µl 6% BSA (Sigma A4503)
200 µl 0.5 M EDTA pH = 8.0 (Fisher, #BP2483-1)
1 ml 10 mg/ml salmon sperm DNA (Ambion #9680)
500 µl 10 mg/ml total yeast RNA (Ambion #7118)
100 µl 50 mg/ml yeast tRNA (Sigma #R8759)
20 ml 50% dextran sulfate (ISC Bioexpress #G50010114)Mix thoroughly at RT, aliquot into appropriate volume, and store at –20 ° C